DownloadOpen source tools for next generation DNA sequencing analysis and visualization
Features
- DNA sequence Analysis
- Deep Sequencing Visualization
- Genotype Frequency Analysis
- Illumina Data Processing
- Molecular Evolution
Follow SEWAL
Other Useful Business Software
Manage your enterprise’s compensation lifecycle and accurately recognize top performers with a digitized, integrated system. Keep employees invested and your HR team in control while preventing compensation chaos.
Rate This Project
Login To Rate This Project
User Reviews
-
Sorry, was not logged in. Here I try again. Can you remove my first post? Thanks again for compiling Sewal for ubunto! Have couple questions about it: 1. Does Sewal only understand data in qseq format? I currently have different selection rounds as *.fa files and *.txt files. Our bioinformatician has already processed them (quality and barcode and correct length-sorting), can I do anything with it now using sewal? my txt files look like this: CTCCCCGTGGTTCCATTCTCCCCCTAGACATGTTGCCCTCATCCT 1 AGCCTTTTCCTTCTCGACTTTATGTCTTCCTGGCTTTTAAGCTAG 5 CTTCTGCCCGAACTGGCCCTCGCTCTACTTTCGGCGTCTCCACCT 3 2. What directory do you recommend to run sewal from? I'm currently running it from /usr/bin/. Where is default location for file output? Do you specify the location every time you process the file?