Download
Open source tools for next generation DNA sequencing analysis and visualization
Features
- DNA sequence Analysis
- Deep Sequencing Visualization
- Genotype Frequency Analysis
- Illumina Data Processing
- Molecular Evolution
Follow SEWAL
Other Useful Business Software
$300 Free Credits for Your Google Cloud Projects
Launch your next project with $300 in free Google Cloud credits—no strings attached. Test, build, and deploy without risk. Use your credits across the entire Google Cloud platform to find what works best for your needs. After your credits are used, continue with always-free tier services. Only pay when you're ready to scale. Sign up in minutes and start exploring.
Rate This Project
Login To Rate This Project
User Reviews
-
Sorry, was not logged in. Here I try again. Can you remove my first post? Thanks again for compiling Sewal for ubunto! Have couple questions about it: 1. Does Sewal only understand data in qseq format? I currently have different selection rounds as *.fa files and *.txt files. Our bioinformatician has already processed them (quality and barcode and correct length-sorting), can I do anything with it now using sewal? my txt files look like this: CTCCCCGTGGTTCCATTCTCCCCCTAGACATGTTGCCCTCATCCT 1 AGCCTTTTCCTTCTCGACTTTATGTCTTCCTGGCTTTTAAGCTAG 5 CTTCTGCCCGAACTGGCCCTCGCTCTACTTTCGGCGTCTCCACCT 3 2. What directory do you recommend to run sewal from? I'm currently running it from /usr/bin/. Where is default location for file output? Do you specify the location every time you process the file?
