Download
Open source tools for next generation DNA sequencing analysis and visualization
Features
- DNA sequence Analysis
- Deep Sequencing Visualization
- Genotype Frequency Analysis
- Illumina Data Processing
- Molecular Evolution
Follow SEWAL
Other Useful Business Software
Cut Data Warehouse Costs up to 54% with BigQuery
BigQuery delivers up to 54% lower TCO than cloud alternatives. Migrate from legacy or competing warehouses using free BigQuery Migration Service with automated SQL translation. Get serverless scale with no infrastructure to manage, compressed storage, and flexible pricing—pay per query or commit for deeper discounts. New customers get $300 in free credit.
Rate This Project
Login To Rate This Project
User Reviews
-
Sorry, was not logged in. Here I try again. Can you remove my first post? Thanks again for compiling Sewal for ubunto! Have couple questions about it: 1. Does Sewal only understand data in qseq format? I currently have different selection rounds as *.fa files and *.txt files. Our bioinformatician has already processed them (quality and barcode and correct length-sorting), can I do anything with it now using sewal? my txt files look like this: CTCCCCGTGGTTCCATTCTCCCCCTAGACATGTTGCCCTCATCCT 1 AGCCTTTTCCTTCTCGACTTTATGTCTTCCTGGCTTTTAAGCTAG 5 CTTCTGCCCGAACTGGCCCTCGCTCTACTTTCGGCGTCTCCACCT 3 2. What directory do you recommend to run sewal from? I'm currently running it from /usr/bin/. Where is default location for file output? Do you specify the location every time you process the file?
